View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13572_high_2 (Length: 313)
Name: NF13572_high_2
Description: NF13572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13572_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 290
Target Start/End: Complemental strand, 44474493 - 44474222
Alignment:
| Q |
19 |
atttctaagccgaaatgtggcaccgtttatcatcatcatcatccaaactcaacctcagaacttgtgcttcagggttagggtttcttacacgatcattctc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474493 |
atttctaagccgaaatgtggcaccgtttatcatcatcatcatccaaactcaacctcagaacttgtgcttcagggttagggtttcttacacgatcattctc |
44474394 |
T |
|
| Q |
119 |
ctctgaaccgggaaagagattcgctgcgttatggggcaacggcgattacggtagattgggtctcggtaatttgaattctcaatggaaacctgctatttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474393 |
ctctgaaccgggaaagagattcgctgcgttatggggcaacggtgattacggtagattgggtctcggtaatttgaattctcaatggaaacctgctatttgc |
44474294 |
T |
|
| Q |
219 |
acctccttccataatcaaaacgttcaagcaattgcttgtggtggcgctcacacgctatttttaacaggttca |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474293 |
acctccttccataatcaaaacgttcaagcaattgcttgtggtggcgctcacacgctatttttaacaggttca |
44474222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University