View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13573_low_2 (Length: 244)
Name: NF13573_low_2
Description: NF13573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13573_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 4587079 - 4587291
Alignment:
| Q |
24 |
ggttagtttctttataagatggccatatagtttaaagttcagtccttgttatctccattcttttatacaatatataaatttcaaagcaagtaaggtaggc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4587079 |
ggttagtttctttataagatggccatatagtttacagttcagtccttgttatctccattcttttatataatatataaatttcaaagcaagtaaggtaggc |
4587178 |
T |
 |
| Q |
124 |
ctcgaagctatccatactttattccaaagggaactttcttgaggagggtgttagatgtaaaaatcattcacttgctttcaccaataaactt-aaatcttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4587179 |
ctcgaagctatccatactttattccaaagggaactttcttgaggggggtgttagatgtaaaaatcattcacttgctttcaccaataaacttaaaatcttt |
4587278 |
T |
 |
| Q |
223 |
gtgctaaccggtt |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4587279 |
gtgctaaccggtt |
4587291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University