View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13573_low_3 (Length: 213)
Name: NF13573_low_3
Description: NF13573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13573_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 41908565 - 41908393
Alignment:
| Q |
20 |
atgcttctattgtgtatgccaccttaatggttgacaaggaggtgagtgtttgaagatacaactttctgattcattagcagtaatttctcacaactagttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
41908565 |
atgcttctattgtgtatgccaccttaatggttgacaaggaggtgagtgtttgaagatacaactttctgattctttagcagtaatttct--caactagttt |
41908468 |
T |
 |
| Q |
120 |
ttcatcatttctatgtcttctgcagttgcaacctgataaagtaaaacgacttatgacggtttctaatggaaagct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41908467 |
ttcatcatttctatgtcttctgcagttgcaacctgataaagtaaaacgacttacgacggtttctaatggaaagct |
41908393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 605439 - 605480
Alignment:
| Q |
127 |
tttctatgtcttctgcagttgcaacctgataaagtaaaacga |
168 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
605439 |
tttctatgtcttctacagttgcaacctaacaaagtaaaacga |
605480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University