View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13576_high_10 (Length: 252)
Name: NF13576_high_10
Description: NF13576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13576_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 43220470 - 43220227
Alignment:
| Q |
1 |
cgcaaatagcaagacgtgcaatcgaacttgctgagagtcgtttgctggaggatggatggcctgaatattatgatggtaagcttggaagatatgttggtag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43220470 |
cgcaaatagcaagacgtgcaattgaacttgctgagagtcgtttgctggaggatggatggcctgaatattatgatggtaagcttggaagatatgttggtag |
43220371 |
T |
 |
| Q |
101 |
aaaagcaagaaaataccaaacatggtctattgcaggttatctggtttctaaaatgatgctggaggatccctcacacttggggatgatttcccttgaagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43220370 |
aaaagcaagaaaataccaaacatggtctattgcaggttatctggtttctaagatgatgctggaggatccctcacacctggggatgatttcccttgaagaa |
43220271 |
T |
 |
| Q |
201 |
gacaaacagatgaaaccagtgcataaaagatcatattcttggac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43220270 |
gacaaacagatgaaaccagtgcataaaagatcatcttcttggac |
43220227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 3 - 244
Target Start/End: Complemental strand, 43229542 - 43229301
Alignment:
| Q |
3 |
caaatagcaagacgtgcaatcgaacttgctgagagtcgtttgctggaggatggatggcctgaatattatgatggtaagcttggaagatatgttggtagaa |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
43229542 |
caaatagcaagacgtgcaattgaacttgccgagagtcgtttactgaaggatggatggcctgaatattatgatggtaaacttggaagatatgttgggaaac |
43229443 |
T |
 |
| Q |
103 |
aagcaagaaaataccaaacatggtctattgcaggttatctggtttctaaaatgatgctggaggatccctcacacttggggatgatttcccttgaagaaga |
202 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||| |||| | || |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43229442 |
aggcaagaaaataccaaacatggtctattgcgggttatttggtggcaaagatgatgctggaggacccctcacacttggggatgatttcccttgaagaaga |
43229343 |
T |
 |
| Q |
203 |
caaacagatgaaaccagtgcataaaagatcatattcttggac |
244 |
Q |
| |
|
||| ||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
43229342 |
caagcagatgaaaccagtgattaaaagatcatcttcttggac |
43229301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University