View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13576_high_14 (Length: 209)
Name: NF13576_high_14
Description: NF13576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13576_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 28806052 - 28806230
Alignment:
| Q |
14 |
tgaaatgaaaagttggtatgtatggagcataagaatatttaacagttaaacataaaatctccctctataattactttgggcggttttagtgaatttgact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28806052 |
tgaaatgaaaagttggtatgtatggagcataagaatatctaacagttaaacataaaatctccctctataattactttgggcggttttagtgaacttgact |
28806151 |
T |
 |
| Q |
114 |
atatcgatatgtgttcccaatttatctgggttattcgattttcaggtcagtaacgggtccttattcgatggttttatct |
192 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
28806152 |
atatcgatatgcattcccaatttatctgggttattcgatttttaggtcagtgacgggtccttattcgatgattttatct |
28806230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University