View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13576_high_14 (Length: 209)

Name: NF13576_high_14
Description: NF13576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13576_high_14
NF13576_high_14
[»] chr8 (1 HSPs)
chr8 (14-192)||(28806052-28806230)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 28806052 - 28806230
Alignment:
14 tgaaatgaaaagttggtatgtatggagcataagaatatttaacagttaaacataaaatctccctctataattactttgggcggttttagtgaatttgact 113  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
28806052 tgaaatgaaaagttggtatgtatggagcataagaatatctaacagttaaacataaaatctccctctataattactttgggcggttttagtgaacttgact 28806151  T
114 atatcgatatgtgttcccaatttatctgggttattcgattttcaggtcagtaacgggtccttattcgatggttttatct 192  Q
    |||||||||||  ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||    
28806152 atatcgatatgcattcccaatttatctgggttattcgatttttaggtcagtgacgggtccttattcgatgattttatct 28806230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University