View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13576_low_12 (Length: 238)
Name: NF13576_low_12
Description: NF13576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13576_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 43220774 - 43220555
Alignment:
| Q |
19 |
tcttcgcaaaactataaccaaagtgatatttggtacaaaatgataatgcatgccataactttgattttgagctgagtttaggtcttatattatctgtatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43220774 |
tcttcgcaaaactataaccaaagtgatatttggtacaaaatgataatgcatgccatacctttgattttgagctgagtttaggtcttatattatctgtaat |
43220675 |
T |
 |
| Q |
119 |
ttgatgttcaaattacaactattttttccaatgaatattgatgtcaactatgattacgggaatcatttttaacaattccttcaatatggtatgctttgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43220674 |
ttgatgttcaaattacaactattttttccaatgaatattgatgtcaactatgattatgggaatcatttttaacaattccttcaatatggtatgctttgga |
43220575 |
T |
 |
| Q |
219 |
atagaattgcatagtccgat |
238 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
43220574 |
atagaattgcatagaccgat |
43220555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University