View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13576_low_12 (Length: 238)

Name: NF13576_low_12
Description: NF13576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13576_low_12
NF13576_low_12
[»] chr1 (1 HSPs)
chr1 (19-238)||(43220555-43220774)


Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 43220774 - 43220555
Alignment:
19 tcttcgcaaaactataaccaaagtgatatttggtacaaaatgataatgcatgccataactttgattttgagctgagtttaggtcttatattatctgtatt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
43220774 tcttcgcaaaactataaccaaagtgatatttggtacaaaatgataatgcatgccatacctttgattttgagctgagtttaggtcttatattatctgtaat 43220675  T
119 ttgatgttcaaattacaactattttttccaatgaatattgatgtcaactatgattacgggaatcatttttaacaattccttcaatatggtatgctttgga 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
43220674 ttgatgttcaaattacaactattttttccaatgaatattgatgtcaactatgattatgggaatcatttttaacaattccttcaatatggtatgctttgga 43220575  T
219 atagaattgcatagtccgat 238  Q
    |||||||||||||| |||||    
43220574 atagaattgcatagaccgat 43220555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University