View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13578_high_7 (Length: 225)
Name: NF13578_high_7
Description: NF13578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13578_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 38091865 - 38091672
Alignment:
| Q |
18 |
gcatgcacaagtacagcatacctttttgcacttgtcaaattttgagctacatcttgagctagtactcagctcaagaagaaaaatcaaaactatgagttaa |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38091865 |
gcatgcacaagtacaacatacctttttgcacttgtcaaattttgagctagatcttgagctagtactcagctcaagaagaaaaatcaaaactatgagttaa |
38091766 |
T |
 |
| Q |
118 |
ttttataacattatttaaagttggaattttatttagtataaagatcttaaatttaacactgacagacacaatgagtagagtttgagagtataat |
211 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38091765 |
ttttataacattttttaaagttagaattttatttagtataaagatctaaaatttaacactaacagacacaatgagtagagtttgagagtataat |
38091672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University