View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13578_high_9 (Length: 219)
Name: NF13578_high_9
Description: NF13578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13578_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 98 - 152
Target Start/End: Complemental strand, 3080989 - 3080935
Alignment:
| Q |
98 |
agtgtgtttttagcttttacttgggattaaaatcacacaatttagattttagaca |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3080989 |
agtgtgtttttagcttttacttgggattaaaatcacacaatttagattttagaca |
3080935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 98 - 152
Target Start/End: Complemental strand, 3095426 - 3095372
Alignment:
| Q |
98 |
agtgtgtttttagcttttacttgggattaaaatcacacaatttagattttagaca |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3095426 |
agtgtgtttttagcttttacttgggattaaaatcacacaatttagattttagaca |
3095372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 150
Target Start/End: Original strand, 4547486 - 4547538
Alignment:
| Q |
98 |
agtgtgtttttagcttttacttgggattaaaatcacacaatttagattttaga |
150 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
4547486 |
agtgtgttattagcttttacttgggactaaaatcatacaatttagattttaga |
4547538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 3081086 - 3081054
Alignment:
| Q |
1 |
catcaattattaggatttagtataccaaattag |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3081086 |
catcaattattaggatttagtataccaaattag |
3081054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 3095523 - 3095491
Alignment:
| Q |
1 |
catcaattattaggatttagtataccaaattag |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3095523 |
catcaattattaggatttagtataccaaattag |
3095491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University