View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13578_low_8 (Length: 220)
Name: NF13578_low_8
Description: NF13578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13578_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 32 - 220
Target Start/End: Original strand, 8628329 - 8628517
Alignment:
| Q |
32 |
agcttgaaatatatcatttccattcataatacaagcttctattcacattgtacatacttgaattagtatgcttttagtggtaaccagattatgaagaaac |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8628329 |
agcttgaaatatatcatttccattcataatacaagcttgtattcacattgtacatacttgaattagtatgcttttagtggtaaccagattatgaagaaac |
8628428 |
T |
 |
| Q |
132 |
ttttctttcttagatatgcaagttatgatgtttccacgaactccacacatggttcacagcaaaaatattgtattgtgacaatgatatta |
220 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8628429 |
ttttctttcttagaaatgcaagttatgatgtttccacaaactccacacatggttcacaacaaaaatattgtattgtgacaatgatatta |
8628517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University