View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13579_high_7 (Length: 239)
Name: NF13579_high_7
Description: NF13579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13579_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 47262356 - 47262579
Alignment:
| Q |
1 |
caccgtagtattcaccacactccataacgttccatcaacgatctgatcaaacaccggcggcgtaagatgatcaacaccgttggctccaccgtagaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47262356 |
caccgtagtattcaccacactccataacgttccatcaatgatctgatcaaacaccggcggcgtaggatgatcaacaccgttgactccaccgtagaaataa |
47262455 |
T |
|
| Q |
101 |
gtagtacgtatcatatattttgcaccgcgatacacaggaatattgtagcagtgttttttaacttggagagggaatgaacgaagggttttgagagttggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47262456 |
gtagtacgtatcatatattttgcaccgcgatacacaggaatattgtagcagtgttttttaacttggagagggaatgaacgaagggttttgagagttggga |
47262555 |
T |
|
| Q |
201 |
gaaggacttgggtggttatgtttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47262556 |
gaaggacttgggtggttatgtttt |
47262579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University