View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13579_low_5 (Length: 284)
Name: NF13579_low_5
Description: NF13579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13579_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 42 - 267
Target Start/End: Complemental strand, 10794592 - 10794360
Alignment:
| Q |
42 |
acataagtttaagttcagtaatttatatcctcaaattattgtggatttgtttatgtgatcaggtatcaagtactagcaggaattattgagcaacggattc |
141 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794592 |
acatatgtttaagttcagtaatttatatcctcaaattattgtggatttgtttatgtgatcaggtatcaagtactagcaggaattattgagcaacggattc |
10794493 |
T |
|
| Q |
142 |
tggaaccattgctacgccaaaacaaacttatactaactggagcatactttattgttagaactgctaatacttattggggctccctactgtaa-------g |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10794492 |
tggaaccattgctacgccaaaacaaacttatactaactggagcatactttattgttagaactgctaatacttattggggctccctactgtaagattattg |
10794393 |
T |
|
| Q |
235 |
atttatctcagttaatatttgtaatctaaaagt |
267 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
10794392 |
atttatctcagttaatatttgtaacctaaaagt |
10794360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 10794735 - 10794703
Alignment:
| Q |
5 |
aattgcagacagttagtaatcaatcaaatattc |
37 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
10794735 |
aattccagacagttagtaatcaatcaaatattc |
10794703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University