View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13579_low_8 (Length: 227)
Name: NF13579_low_8
Description: NF13579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13579_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 33814275 - 33814058
Alignment:
| Q |
18 |
agagacacggctaaaagtggtcagtgaggttactcaagaatctctgctttcttaatttttgtctagttttcgagttggatttctaacttatatttttagg |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33814275 |
agagacccggctaaaagtggtcagtgaggttactcaagaatctctgctttcttaatttttgtctagttttcgagttggatttctaacttatatttttagg |
33814176 |
T |
 |
| Q |
118 |
tattgaaggttaaaagtttt--------tgtgtgatatcatatggtttattgtttttgcttgacccttgacttgtttttgagaactaattgagtctgaaa |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33814175 |
tattgaaggttaaaagtttttgtgaatttgtgtgatatcatatggtttagtgtttttgcttgacccttgacttgtttttgataactaattgagtctgaaa |
33814076 |
T |
 |
| Q |
210 |
tataggttgggatgccaa |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33814075 |
tataggttgggatgccaa |
33814058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University