View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1357_low_10 (Length: 404)
Name: NF1357_low_10
Description: NF1357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1357_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 98 - 382
Target Start/End: Original strand, 51403329 - 51403613
Alignment:
| Q |
98 |
ggcataggaacatccattgttcttagagccacaatctccaaaggtgcacaacctgtccctttccttgtcttcatgggtgttgctctctcaatcacagcat |
197 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51403329 |
ggcataggaacatccgttgttcttagagccacaatctccaaaggtgcacaacctgtccctttccttgtcttcatgggtgttgctctctcaatcacagcat |
51403428 |
T |
|
| Q |
198 |
ttcccgtcctcgctcgaatcctagctgagctcaaactgctaaccacggatgttggtcgtatagcaatgtcagcagctgctgttaatgatgttgcagcctg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51403429 |
ttcccgtcctcgctcgaatcctagctgagctcaaactgctaaccacggatgttggtcgtatagcaatgtcagcagctgctgttaatgatgttgcagcctg |
51403528 |
T |
|
| Q |
298 |
ggtacttctcgctctagccatatcattatctggcgatgacacgtcgcccctgatttcactttgggttatgctctgtggtgctgct |
382 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51403529 |
ggtacttcttgctctagccatatcattatctggcgatgacacgtcgcccctgatttcactttgggttatgctctgtggtactgct |
51403613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 158 - 312
Target Start/End: Complemental strand, 29983438 - 29983284
Alignment:
| Q |
158 |
ttccttgtcttcatgggtgttgctctctcaatcacagcatttcccgtcctcgctcgaatcctagctgagctcaaactgctaaccacggatgttggtcgta |
257 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||| ||||| ||||| ||||||||||||||||| |||||||| || || || ||||||||||| | |
|
|
| T |
29983438 |
ttccttgttttcatgggcgttgctctctcgatcacagcctttcctgtccttgctcgaatcctagctgaactcaaactcctcacaaccgatgttggtcgga |
29983339 |
T |
|
| Q |
258 |
tagcaatgtcagcagctgctgttaatgatgttgcagcctgggtacttctcgctct |
312 |
Q |
| |
|
| ||||||||||| |||||||| ||||| || || || ||| ||||||| ||||| |
|
|
| T |
29983338 |
tggcaatgtcagctgctgctgtcaatgacgtcgctgcttggatacttcttgctct |
29983284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University