View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1357_low_19 (Length: 320)
Name: NF1357_low_19
Description: NF1357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1357_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 29908238 - 29907999
Alignment:
| Q |
8 |
aatgtcttctgcaatgttgaaaggtgttaggtttgataacaagggtcttaggtctggtcacagaggtatcgcagctttgatttggtgtctgatgttgttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
29908238 |
aatgtcttctgcaatgttgaaaggtgttaggtttgataacaagggtcttaggtctggtcacagaggtatcgcagctttgatttgctgtctgatgttcttc |
29908139 |
T |
|
| Q |
108 |
ctggaaaggagtcttggggattcaagcttcatgttgttcgtttgtgggaggtgcgtgcttttcttcaatcataacagatcaattcgattgagatggtgtt |
207 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29908138 |
ctggaagagagtcttggagattcaagcttcgtgttgttcgtttgtgggaggtgcgtgattttcttcaatcataacagatcaattcaattgagatggtgtt |
29908039 |
T |
|
| Q |
208 |
tgttgatgagaaggtttgtattgctgtttgtttgcctttg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29908038 |
tgttgatgagaaggtttgtattgctgtttgtttgcctttg |
29907999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 78 - 223
Target Start/End: Complemental strand, 29908984 - 29908839
Alignment:
| Q |
78 |
gcagctttgatttggtgtctgatgttgttcctggaaaggagtcttggggattcaagcttcatgttgttcgtttgtgggaggtgcgtgcttttcttcaatc |
177 |
Q |
| |
|
|||| |||||| || | ||||||| || ||||||||||||||||||| |||||| ||| ||| || ||| ||||||||| | ||| |||||||| | |
|
|
| T |
29908984 |
gcagttttgatctgttatctgatgctgctcctggaaaggagtcttggagattcattgttcgtgtggtgcgtctgtgggaggctcctgcgtttcttcatcc |
29908885 |
T |
|
| Q |
178 |
ataacagatcaattcgattgagatggtgtttgttgatgagaaggtt |
223 |
Q |
| |
|
||||| | |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29908884 |
tgaacaggtgaattcggttgagatggtgttggttgatgagaaggtt |
29908839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University