View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1357_low_20 (Length: 307)
Name: NF1357_low_20
Description: NF1357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1357_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 29 - 301
Target Start/End: Complemental strand, 32140257 - 32139985
Alignment:
| Q |
29 |
agtttgcatgaagcacaaggagaagtagtattaccacccatttgattatgaaaaaacagagaaaacaagagaagtttatggaacacacttaggaaaggaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32140257 |
agtttgcatgaagcacaaggagaagtagtattaccacccatttgattatgaaaaaacagagaaaacaagagaagtttatggaacacacttaggaaaggaa |
32140158 |
T |
 |
| Q |
129 |
tgagagagacttatatttataataaatggccaacggcgtgtgagactatagccgctacattgtgcaaatataatattgctatcaaatagaatagactaaa |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
32140157 |
tgagagagac-tatatttataataaatggccaacggcgtgtgagactatagccgctacattgtgcaaatataatattgctataaaatagaatagactcaa |
32140059 |
T |
 |
| Q |
229 |
cttattgatatt-annnnnnnnatttaaataattttatatggagtattttgggttattcaaatctctctgctcc |
301 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32140058 |
cttattgatattaattttttttatttaaataattttatatggagtattttgggttattcaaatctctcttctcc |
32139985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University