View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1357_low_21 (Length: 299)
Name: NF1357_low_21
Description: NF1357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1357_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 69 - 248
Target Start/End: Complemental strand, 41061660 - 41061481
Alignment:
| Q |
69 |
aggaactactttaccacgcatataatccagcagcgtagtttttccactccccatatgacccaacattgagcaaattggagcacggatagggttctcaata |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41061660 |
aggaactactttaccacgcatataatccagcagcgtagtttttccactccccatatgacccaacattgagcaaattggagcacggatagggttctcaata |
41061561 |
T |
|
| Q |
169 |
attatagaagctgcttttgcagctgcaaaagcttcagcctcagcagcagccctaccagccctcgccgttttcgaattcat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41061560 |
attatagaagctgcttttgcagctgcaaaagcttcagcctcagcagcagccctaccagccctcgccgatttcgaattcat |
41061481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University