View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1357_low_27 (Length: 254)
Name: NF1357_low_27
Description: NF1357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1357_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 33 - 241
Target Start/End: Complemental strand, 2329742 - 2329534
Alignment:
| Q |
33 |
attaattcgtctttttgggaatttggagaatagacttttggatttataataatcaacattgactgactcaggtaaggagagtagaatgttatgaatacta |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2329742 |
attaattcgtctttttgggaatttggagaatagacttttggatttataataatcaacattgactgactcaggtaaggagagtagaatgttatgaatacta |
2329643 |
T |
 |
| Q |
133 |
agatatgtatactttcataaaagtattagaannnnnnnnnnnnnnaaaaatattttatggaaaccatttgaataattttacggatccacaccattatata |
232 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2329642 |
agatttgtatactttcataaaagtattagaatttttatttttttaaaaaatattttatggaaaccatttgaataattttacggatacacaccattatata |
2329543 |
T |
 |
| Q |
233 |
tcgtttgtg |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
2329542 |
tcgtttgtg |
2329534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University