View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13581_high_9 (Length: 237)
Name: NF13581_high_9
Description: NF13581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13581_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 42738440 - 42738670
Alignment:
| Q |
1 |
aacattatatgtgaatttgctttgggttgtcatctgtctatcaagttgactgtctcttagcaattacatttgattgaaatatagaagtaaaatgtcaata |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738440 |
aacattagatgtgaatttgctttgggttgtcatctgtctatgaagttgactgtctcttagcaattacatttgattgaaatatagaagtaaaatgtcaata |
42738539 |
T |
 |
| Q |
101 |
tagcaaca--nnnnnnnnatgaatagagtatgatttgtattcatctatctatgttggtggatttaatatatcttgtatttatatcttatgaataaaagaa |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42738540 |
tagcaacattttttttttatgaatagagtatgatttgtatccatctatctatgttggtggatttaatatctcttgtatttatatcttatgaataaaagaa |
42738639 |
T |
 |
| Q |
199 |
ttgtttgctgttaaaagaaaatgtgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
42738640 |
ctgtttgctgttaaaagaaaatgtgaagatg |
42738670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University