View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13581_low_6 (Length: 273)
Name: NF13581_low_6
Description: NF13581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13581_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 41659656 - 41659910
Alignment:
| Q |
1 |
gaaacgctgtacgcgacaccgaaacaagttcctgaatgctcatgtctttcaagtttctatggtcattcgaacacatcccaggttcgattttgggtttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
41659656 |
gaaacgctgtacgcgacaccgaaacaagttcctgaatgctcatgtcttccaagtttctatggtcatttgaacacaacccaggttcgattttgggtttatg |
41659755 |
T |
 |
| Q |
101 |
ttccatgagaagccttaaagatgcaaactttaggggaaatggggtttaacagaaaatgggtttcacgaaaagttggtgggttttgatgaaaatggtgggt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41659756 |
ttacatgagaagccttaaagatgcaaactttaggggaaatggggtttaacagaaaatgggtttcacgaaaagttggtgggttttgatgaaaatggtgggt |
41659855 |
T |
 |
| Q |
201 |
acgaaagaatatgaggaaggaaaggagacagaaacataatcatgaaaatagatga |
255 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41659856 |
atgaaagaatatgaggaaggaaaggagacagaaacaaaatcatgaaaatagatga |
41659910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 106
Target Start/End: Complemental strand, 41687666 - 41687576
Alignment:
| Q |
16 |
acaccgaaacaagttcctgaatgctcatgtctttcaagtttctatggtcattcgaacacatcccaggttcgattttgggtttatgttccat |
106 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||||| ||| |||||||||||| |||||| || ||||||||| ||||||||| ||| ||||| |
|
|
| T |
41687666 |
acacagaaaccagttcatgaatgctcatgtcttccaaatttctatggtcactcgaactcaacccaggttcagttttgggttgatgctccat |
41687576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University