View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13582_high_7 (Length: 260)
Name: NF13582_high_7
Description: NF13582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13582_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 82 - 240
Target Start/End: Complemental strand, 34020749 - 34020591
Alignment:
| Q |
82 |
gaggttcatatatgtatcgggtgagcctacggatgtatactattattactctgctgctcaaaatagagctgtagggtttatggttttggcttgtttggga |
181 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34020749 |
gaggttcatatatgtgtcgggtgagcctacggatgtatactattattactctgctgctcaaaatagagctgtagggtttatggttttggcttgtttggga |
34020650 |
T |
 |
| Q |
182 |
gcaatgtcaatcactattatatttgggtgacttcatgaagctgatcttaatcatcaaga |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34020649 |
gcaatgtcaatcactattatatttgggtgacttcatgaagctgatcttactcatcaaga |
34020591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University