View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13582_low_7 (Length: 349)
Name: NF13582_low_7
Description: NF13582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13582_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 24524336 - 24524129
Alignment:
| Q |
18 |
ccttcaatccacaattcctccaaacttggaaataacttcctgcattcattggcacgatactgcatccaaatttatttctgatattacgaaaattcccctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24524336 |
ccttcaatccacaattcctccaaacttggaaataacttcctgcattcattggcacgatactgcatccaaatttatttctgatattacgaaaattcccctc |
24524237 |
T |
|
| Q |
118 |
gtcttacattcaaccattcaggatattgaaacggacaagatctcgcttgagattttgtcttctaagttctgttagatgcatgcttcaacatggtttattt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| | |||||||| | |
|
|
| T |
24524236 |
gtcttacattcaaccattcaggatattgaaacggacaagatctcgcttgagattttgtcttctaatttctgttagatgaatgcttcagcgtggtttatat |
24524137 |
T |
|
| Q |
218 |
atgcattt |
225 |
Q |
| |
|
||| |||| |
|
|
| T |
24524136 |
atggattt |
24524129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 169 - 347
Target Start/End: Complemental strand, 24524090 - 24523908
Alignment:
| Q |
169 |
attttgtcttctaagttctgttagatgcatgcttcaacatggtttatttatgcatttattctctattaagtatcaacaaaaag-ataagtatgcaatatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24524090 |
attttgtcttctaagttctgttagatgcatgcttcaacatggtttatttatacatttattctctattaagtatcaacaaaaagaataagtatgcaatatt |
24523991 |
T |
|
| Q |
268 |
aaaa--ggataaaaatt-ggcacatatc--tatgtatccatcttgtaaacggcagctcaaaatatatgttcatagattgtctgtg |
347 |
Q |
| |
|
|||| | ||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24523990 |
aaaaaggaataaaaattaggcacatatctatatgtatccatcttgtaaacggcagctcaaa--atatgttcatagattgtctgtg |
24523908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University