View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13583_high_14 (Length: 300)
Name: NF13583_high_14
Description: NF13583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13583_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 117 - 289
Target Start/End: Complemental strand, 37086303 - 37086131
Alignment:
| Q |
117 |
acagacaaggataatgatggaaaaagagaggcttgaatggcttccgaatcatttaaagatgctgaagatggacaatgacttcgattcggttgaggaaagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37086303 |
acagacaaggataatgatggaaaaagagaggcttgaatggcttccgaatcatttaaagatgctgaagatggacaatgacttcgattcggttgaggaaagg |
37086204 |
T |
|
| Q |
217 |
gaatgttactattgcttctatgacttgcacctctctgctgttggttgcgagtgctttcctgacaactattcat |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37086203 |
gaatgttactattgcttctatgacttgcacctctctgctgttggttgcgagtgctttcctgacaactattcat |
37086131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 37086404 - 37086368
Alignment:
| Q |
16 |
ttcatatatttagaaaaatccgtaaaactttggatgg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37086404 |
ttcatatatttagaaaaatccgtaaaactttgtatgg |
37086368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University