View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13583_high_19 (Length: 243)
Name: NF13583_high_19
Description: NF13583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13583_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 12607986 - 12608192
Alignment:
| Q |
20 |
agagtatggttttattaggctgttcagctttattgggtattttagtctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgattc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607986 |
agagtatggttttattaggctgttcagctttattgagtattttactctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgattc |
12608085 |
T |
|
| Q |
120 |
aacgatatacaattcaagtatctgagtttgagttgttggtgcacccttccttgcctgcattctagcttaccttccttcattcaccccaattcttacgcct |
219 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12608086 |
aaggatatacaattcgagtatctgagtttgagttgttggtgcacccttccttggctgcattctagcttaccttccttcattcaccccaattcttacgcct |
12608185 |
T |
|
| Q |
220 |
ttatttc |
226 |
Q |
| |
|
||||||| |
|
|
| T |
12608186 |
ttatttc |
12608192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University