View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13584_low_13 (Length: 229)
Name: NF13584_low_13
Description: NF13584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13584_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 103 - 228
Target Start/End: Original strand, 41598066 - 41598193
Alignment:
| Q |
103 |
gtgaataattcaaaagtggttgaacaatcaaattggactttcaattttcaaacgattgtg--tatggaaggtaaatacatcgtttttctaccctcgattg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41598066 |
gtgaataattcaaaagtggctgaacaatcaaattggactttcaattttcaaacgattgtgtgtatggaaggtaaatacatcgtttttccaccctcgattg |
41598165 |
T |
 |
| Q |
201 |
tccgcataacctctcttgatgatgatgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41598166 |
tccgcataacctctcttgatgatgatgt |
41598193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 41597961 - 41597989
Alignment:
| Q |
1 |
gcttattttggtcatcttcaagaaaactg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41597961 |
gcttattttggtcatcttcaagaaaactg |
41597989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University