View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13586_low_12 (Length: 227)

Name: NF13586_low_12
Description: NF13586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13586_low_12
NF13586_low_12
[»] chr5 (1 HSPs)
chr5 (1-221)||(22083958-22084178)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 22083958 - 22084178
Alignment:
1 cttcttacgattcagcttccattggtaacaatgatactatacttgttaactatggtagagtctcttgcggttcgaatcagtggggtccgggtttcacaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22083958 cttcttacgattcagcttccattggtaacaatgatactatacttgttaactatggtagagtctcttgcggttcgaatcagtggggtccgggtttcacaaa 22084057  T
101 cgatgatgaccggttcggtaggtcttggcagtcagattcagacaatcgaatctccggttcgggttcaggacggaacaaggtggttgcggtttctacaagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
22084058 cgatgatgaccggttcggtaggtcttggcagtcagattcagactatcgaatctccggttcgggttcacgacggaacaaggtggttgcggtttctacaagg 22084157  T
201 agaaacattgctggaactaat 221  Q
    |||||||||||||||||||||    
22084158 agaaacattgctggaactaat 22084178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University