View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13586_low_6 (Length: 397)
Name: NF13586_low_6
Description: NF13586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13586_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 21 - 392
Target Start/End: Complemental strand, 45541338 - 45540970
Alignment:
| Q |
21 |
tcagcagcttttgcttcagttaccttcaaaccttcttcgtgaagttcggcagttcccttgcttatagcgttgaatttattcacaggtactggaggttgat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541338 |
tcagcagcttttgcttcagttaccttcaaaccttcttcgtgaagttcggcagttcccttgctaatagcgttgaatttattcacaggtactggaggttgat |
45541239 |
T |
 |
| Q |
121 |
gatttggcgaagcaatatgctgatcggacatatatacatcaccagacttatctaaatcagaagaagatttgaagcaagctagttcacttgagaaacttgt |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45541238 |
gatttggcgaagcaatatactgatcggacatacatacatcaccagacttatctaaatcagaaga---tttgaagcaagctagttcacttgagaaacttgt |
45541142 |
T |
 |
| Q |
221 |
atttcccatataaatgctgaagagtgattcgttagaggcagtgctccattctactggggcatttgtattgtttctagcaaatacatgagatggaaagaca |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541141 |
atttcccatataaatgctgaagagtgattcgttagaggcagtgctccattctactggggcatttgtattgtttctagcaaatacatgagatggaaagaca |
45541042 |
T |
 |
| Q |
321 |
tattgggcattagtcacattttcacttggacgctccatcaattgtatcggcgggttttgtatctctgctcct |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45541041 |
tattgggcattagtcacattttcacttggacgctccatcaattgtatcggcgggttttgtatctctggtcct |
45540970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University