View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13587_high_5 (Length: 315)
Name: NF13587_high_5
Description: NF13587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13587_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 6 - 303
Target Start/End: Original strand, 39298907 - 39299204
Alignment:
| Q |
6 |
gtcgaagaatatgccgcagtccaccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctcta |
105 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298907 |
gtcgaataatgtgccgcagtccaccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctcta |
39299006 |
T |
|
| Q |
106 |
cagtaacatcctttgcctgaacaactgcagacttggctttctccgccacaggggtagcatattctgttgcagtttttgcagcgcttgaaacagtgtcttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299007 |
cagtaacatcctttgcctgaacaactgcagacttggctttctccgccacaggggtaacatattctgttgcagtttttgcagcgcttgaaacagtgtcttt |
39299106 |
T |
|
| Q |
206 |
tgttgcttcataaccttgttgtgttttctcaagagttgcatctttggcttgtgctgctttctccattgcttgtgctgttttctctcgtgttgtttgtg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39299107 |
tgttgcttcataaccttgttgtgttttctcaacagttgcatctttggcttgtgctgctttctccattgcttgtgctgttttctctcgagttgtttgtg |
39299204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University