View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13587_high_8 (Length: 226)
Name: NF13587_high_8
Description: NF13587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13587_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 31520075 - 31519866
Alignment:
| Q |
1 |
catctgagcctttgaatgagagaaaattattcgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520075 |
catctgagcctttgaatgggagaaaattatacgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaa |
31519976 |
T |
 |
| Q |
101 |
gaaagaaaggcaacttttgaaacgtgctcaaatgcaagcagctcgtgcctttgttccttcacatttccataacagattcatctcatcaccgcagtggctg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31519975 |
gaaagagaggcaacttttgaaacgtgctcaaatgcaagcagctcgtgcctttgttccttcacatttccataacagattcatctcatcaccgcagtggctg |
31519876 |
T |
 |
| Q |
201 |
ccacaacaaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
31519875 |
ccacaacaaa |
31519866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 33 - 109
Target Start/End: Complemental strand, 15575116 - 15575040
Alignment:
| Q |
33 |
gagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaagaaag |
109 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
15575116 |
gagtgtcaatattgtttcaaagaatttgcaaattcacaagcattaggaggccatcaaaatgcacacaagaaagaaag |
15575040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 32 - 106
Target Start/End: Complemental strand, 22863319 - 22863245
Alignment:
| Q |
32 |
cgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaaga |
106 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || |||||| |||| ||||||||||| |||||||| ||||| |
|
|
| T |
22863319 |
cgagtgtcaatattgttgtcgagaatttgcaaactcgcaagccctaggtggacaccaaaacgcacacaaaaaaga |
22863245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 107
Target Start/End: Original strand, 49774318 - 49774393
Alignment:
| Q |
32 |
cgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaagaa |
107 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||||||| | || ||||||||||| || ||||| |||||| |
|
|
| T |
49774318 |
cgagtgccaatattgttgcagagagtttgcaaattcacaagcccttggcggacaccaaaacgctcacaaaaaagaa |
49774393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 63 - 100
Target Start/End: Original strand, 39663801 - 39663838
Alignment:
| Q |
63 |
aattcacaagccttaggaggacaccaaaatgcacacaa |
100 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
39663801 |
aattcacaagccttagggggtcaccaaaatgcacacaa |
39663838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University