View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13587_low_7 (Length: 250)
Name: NF13587_low_7
Description: NF13587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13587_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 37204416 - 37204622
Alignment:
| Q |
18 |
accacctacatctctaaatacaggatgccatcgagtatattgctggaattaataaagttgttcgtttataatattaactttgttgaaagttgatattatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37204416 |
accacctacatctctaaatacaggatgccatcgagtatattgctggaattaataaagtt----gtttataatattaactttgttgaaagttgatataatt |
37204511 |
T |
 |
| Q |
118 |
tttacaa---------attcaag--nnnnnnnnttgattaatgtttttattaaagtatgacttaaatatgtttttagttcccaaaatataccaattttaa |
206 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
37204512 |
tttacaaatttatatcattcaagaaaaaaaaagttgattaatgtttttattaaagtatgacttaaatatgtttttagttccctaaatataccaattttca |
37204611 |
T |
 |
| Q |
207 |
tttttagtcca |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
37204612 |
tttttagtcca |
37204622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University