View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13588_high_16 (Length: 317)
Name: NF13588_high_16
Description: NF13588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13588_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 306
Target Start/End: Original strand, 48669263 - 48669550
Alignment:
| Q |
19 |
attttcttcaatctgtgaaccttaagtatgtgaaattgggttaccattatctgataaaccatggtgtttatttgttcactataccaattctacttgttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669263 |
attttcttcaatctgtgaaccttaagtatgtgaaattgggttaccattatctgataaaccatggtgtttatttgttcactataccaattctacttgttgt |
48669362 |
T |
 |
| Q |
119 |
gtttagtgctgaggttggtagtcttagcaaagaagatctttggaagaagatttgggaagatgcaacttatgatcttgcatctgttctctcttctcttgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669363 |
gtttagtgctgaggttggtagtcttagcaaagaagatctttggaagaagatttgggaagatgcaacttatgatcttgcatctgttctctcttctcttgct |
48669462 |
T |
 |
| Q |
219 |
gtctttgttttcactttcactctttacttcatgtcaaggccacgtcctatttatctcattgattttgcatgctatcaacctgatgatg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669463 |
gtctttgttttcactttcactctttacttcatgtcaaggccacgtcctatttatctcattgattttgcatgctatcaacctgatgatg |
48669550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University