View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13588_high_24 (Length: 232)
Name: NF13588_high_24
Description: NF13588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13588_high_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 35022127 - 35022339
Alignment:
| Q |
20 |
tctccgatactaattcatctttcttgatcaatctttatccctacaatctctaccgtttacgtcctgagattcctcttggaatcgcgctttttcaagaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35022127 |
tctccgatactaattcatctttcttgatcaatctttatccctacaatctctaccgtttacgtcctgagattcctctcggaatcgcgctttttcaagaaca |
35022226 |
T |
 |
| Q |
120 |
tccgtttaacttccgtgacgatttcactaccggagttcgttataaaaacctctttgatattatggttgatgctgtggtttcagcaatggcgctggaaggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022227 |
tccgtttaacttccgtgacgatttcactaccggagttcgttataaaaacctctttgatattatggttgatgctgtggtttcagcaatggcgctggaaggt |
35022326 |
T |
 |
| Q |
220 |
tacgaaacgattc |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35022327 |
tacgaaacgattc |
35022339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University