View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13588_high_27 (Length: 224)
Name: NF13588_high_27
Description: NF13588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13588_high_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 39 - 224
Target Start/End: Complemental strand, 10182941 - 10182754
Alignment:
| Q |
39 |
gttgacttttattaaataaagtatatgtatgtattcttgtttttcggtttgtaggatatagcaaagttgatttctttttgtt--aatttaaagcctcaat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10182941 |
gttgacttttattaaataaagtatatgtatgtattcttgtttttcggtttgtaggatatagcaaagttgatttctttttgttaaaatttaaagcctcaat |
10182842 |
T |
 |
| Q |
137 |
tttcaactcatcaacattttaatctcagctcaaacctgttgaactacccaaccctccagcggtaaagtctcgggttttcagatgaacg |
224 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||| | ||||||||||||||||||| |||||||| |
|
|
| T |
10182841 |
ttttaactcatcaacattttaatctcagctcaaatctgttgaactacccaatcctccggtggtaaagtctcgggttttcggatgaacg |
10182754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University