View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13588_low_18 (Length: 352)
Name: NF13588_low_18
Description: NF13588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13588_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 16 - 337
Target Start/End: Original strand, 50488907 - 50489226
Alignment:
| Q |
16 |
cagaaatcagtagttgattcaatatctttcaatgtgtgtgacatagaagatgaagtcttggtttggacactgatgaacagtaaccttgcatatttgctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50488907 |
cagaaatcagtagttgattcaatatctttcaatgtg--tgacatagaagatgaagtcttggtttggacactgatgaacagtaaccttgcatatttgctta |
50489004 |
T |
|
| Q |
116 |
ccttcctccaattggattggcagcagcaatgacagaacagcgtgcctgaagagatgtgacaattccagcttttgatatgcttatgctctgctgctccatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50489005 |
ccttcctccaattggattggcagcagcaatgacagaacagcgtgcctgaagagatgtgacaattccagcttttgatatgcttatgctctgctgctccatg |
50489104 |
T |
|
| Q |
216 |
gcttcatggatacttaccctgataatatttatcttagtggtaaagcataactgaaaacatacgataatcataaataacataaaagactacaatatctatt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50489105 |
gcttcatggatacttaccctgataatatttatcttagtggtaaagcataactgaaaacatatgataatcataaataacataaaagactacaatatctatt |
50489204 |
T |
|
| Q |
316 |
ttcttaccgatcctggtcattc |
337 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
50489205 |
ttcttaccgatcctggtcattc |
50489226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University