View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13588_low_25 (Length: 249)
Name: NF13588_low_25
Description: NF13588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13588_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 39731073 - 39730844
Alignment:
| Q |
1 |
caaatgcggtcatatcagcggggctttgcttaggatcgtttgaatcgtggctatcctgcaatcacaaacgaaaacaaaatgagataatgcaacggaaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39731073 |
caaatgcggtcatatcagcggggctttgcttaggatcgtttgaatcgtggctatcctgcaatcacaaacgaaaacaaaatgagataatgcaacggaaacg |
39730974 |
T |
|
| Q |
101 |
aaaccagatcccaaattttgaaaaccctaatttcataaatacgcagattcctgaatgaaatcgtgaaatgaaaaggaattaacgatgagatgtaaataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39730973 |
aaaccagatcccaaattttgaaaaccctaatttcataaatacgcagattcctgaatgaaatcgtgaaatgaaaaggaattaacgatgagatgtaaataaa |
39730874 |
T |
|
| Q |
201 |
tttggagaaaaaaccctaaccatgagattt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39730873 |
tttggagaaaaaaccctaaccatgagattt |
39730844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University