View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13588_low_35 (Length: 223)
Name: NF13588_low_35
Description: NF13588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13588_low_35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 47 - 223
Target Start/End: Original strand, 33049975 - 33050167
Alignment:
| Q |
47 |
tgtggtcttagaagaatccaaagatttggatgtgatgaagattgaagaacttcaagcaagccttgaagcact----------------gataggaacaaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33049975 |
tgtggtcttagaagaatccaaagatttggatgtgatgaagattgaagaacttcaagcaagccttgaagcacatgaattgaggttaaccgataggaacaaa |
33050074 |
T |
 |
| Q |
131 |
gaaaaatccaaaggttttgcattagatcaagctttgcaagctcaatatacaaataaaaggaaatacaagaaaggaaagaattattggaatgat |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33050075 |
gaaaaatccaaaggttctgcattagatcaagctttgcaagctcaatatacaaataaaaggaaatgcaagaaaggaaagaattattggaatgat |
33050167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 21 - 115
Target Start/End: Complemental strand, 28452219 - 28452125
Alignment:
| Q |
21 |
ttgacaccaagatttgatcatattgttgtggtcttagaagaatccaaagatttggatgtgatgaagattgaagaacttcaagcaagccttgaagc |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| | || ||||| |||||||| |
|
|
| T |
28452219 |
ttgacaccaaggtttgatcatattgttgtagtcttagaagaatccaaagatttggatgtgatcaagattgaagaattgcaggcaagtcttgaagc |
28452125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University