View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13589_high_2 (Length: 245)
Name: NF13589_high_2
Description: NF13589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13589_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 51351186 - 51351360
Alignment:
| Q |
18 |
gattttgtgtctgttaaatgcgattttagcaattctgttgtctgctgttgggttagtgttagattttttgaataggcaaatgttagtaattagtttgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51351186 |
gattttgtgtctgttaaatgcgattttagcaattctgttgtctgctgttgggttagtgttagattttttgaataggcaaatgttagtaattagtttgtta |
51351285 |
T |
|
| Q |
118 |
ggaggaaggtgaaacattaacagaaaattgattgaacttggacgtagctcattctttgtccgaatctaaattatt |
192 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51351286 |
ggaggaaggtgaaacgttaacagaaaattgattgaacttagacgtagctcattctttgtccgaatctaaattatt |
51351360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 245
Target Start/End: Original strand, 51351359 - 51351397
Alignment:
| Q |
207 |
ttcggagactttgcccagttagtgttaaataaaattgat |
245 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
51351359 |
ttcggagactttgcccaggtagtgttagataaaattgat |
51351397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 121
Target Start/End: Original strand, 12038052 - 12038084
Alignment:
| Q |
89 |
ataggcaaatgttagtaattagtttgttaggag |
121 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
12038052 |
ataggcaaatgttagtagttagtttgttaggag |
12038084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University