View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_100 (Length: 294)
Name: NF1358_high_100
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_100 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 30 - 279
Target Start/End: Complemental strand, 30783938 - 30783689
Alignment:
| Q |
30 |
taaatgtctagggaaaccctgtaaatcctgatcttaatagaattagtaactaccaagttttattcattctcattccaagaaccggaaatttgatcaaatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783938 |
taaatgtctagggaaaccctgtaaatcctgatcttaatagaattagtaactaccaagttttattcattctcattccaagaaccggaaatttgatcaaatt |
30783839 |
T |
 |
| Q |
130 |
aggaatgccatattcggactatgttagttatgtaactatatcaacaacactcgttaaaataatttgtgattgttctgttataaacaaaacgtggatgctt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783838 |
aggaatgccatattcggactatgttagttatgtaactatatcaacaacactcgttaaaataatttgtgattgttctgttataaacaaaacgtggatgctt |
30783739 |
T |
 |
| Q |
230 |
attgcaaaggtaattgcatagtacttttgagaatagtgatttcccttcat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783738 |
attgcaaaggtaattgcatagtacttttgagaatagtgatttcccttcat |
30783689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University