View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_102 (Length: 289)
Name: NF1358_high_102
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 67 - 243
Target Start/End: Original strand, 23026756 - 23026929
Alignment:
| Q |
67 |
ataatattcgtgcaaatgctgtggcacctggacctgttaagacatcacttttggaatcagtcatggtatgcatttgttcatgtaatatttatataggact |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23026756 |
ataatattcgtgcaaatgctgtggcacctggacctgttaagacatcacttttggaatcagtcatggtatgcatttgttcatgt-atatttatataggac- |
23026853 |
T |
|
| Q |
167 |
ataggggtagttccagcatgttatgaaaggtatcgaccaaagtctccgtgagcttatctcatttgattaagaataat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
23026854 |
-taggggtagttccagcatgttatgaaaggtatcgagcaaagtctccgtgagcttatctcatttggttaaggataat |
23026929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 124
Target Start/End: Original strand, 23037153 - 23037210
Alignment:
| Q |
67 |
ataatattcgtgcaaatgctgtggcacctggacctgttaagacatcacttttggaatc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
23037153 |
ataatattcgtgcaaatgctgtggcacctggacctgtcaagacatcactcttgcaatc |
23037210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 67 - 106
Target Start/End: Original strand, 23058109 - 23058148
Alignment:
| Q |
67 |
ataatattcgtgcaaatgctgtggcacctggacctgttaa |
106 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
23058109 |
ataatattcgagcaaatgttgtggcacctggacctgttaa |
23058148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 121
Target Start/End: Original strand, 23092577 - 23092631
Alignment:
| Q |
67 |
ataatattcgtgcaaatgctgtggcacctggacctgttaagacatcacttttgga |
121 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| | ||| | ||||||||| |
|
|
| T |
23092577 |
ataatattcgtgctaatgttgtggcacctggacctgtgatgaccttacttttgga |
23092631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University