View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_103 (Length: 287)
Name: NF1358_high_103
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 28691577 - 28691828
Alignment:
| Q |
1 |
attatagacatgtatagcttgtacgctcccatgtgtttcagcaatatcagcaacgtcagaagggaagcccctcattcttctttttccaaattggtactgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
28691577 |
attatagacatgtatagcttgtacgctcccatgtgtttcagcaatatcagcaacgtcagaag---------tcattctt---tttccaaattggtactgg |
28691664 |
T |
 |
| Q |
101 |
tgagttaattcatcaatttagaacttaaaaactagtacacgtatactacagcaactaaagttacttgcctattgaaattgtcgattttaataggacgggt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28691665 |
tgagtt---tcatcaatttagaacttaaaaactagtacac------tactgcaactaacgttacttgcctattgaaattgtcaattttaataggacgggt |
28691755 |
T |
 |
| Q |
201 |
ggcataaaaatctagcaggatatgatccatgtgcatcagattatactgcagcatacctaaataggccacaggt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28691756 |
ggcataaaaatctagcaggatatgatccatgtgcatcagattatactgcagcatacctaaataggccagaggt |
28691828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University