View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_104 (Length: 284)
Name: NF1358_high_104
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 30 - 164
Target Start/End: Complemental strand, 20539616 - 20539482
Alignment:
| Q |
30 |
gcataaaacagcaccatagagaaaaatggcatatacatctgagacacgatatcatatgagagtaaatcagaaaaatagcagcagctcgtcgtgaaaagaa |
129 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20539616 |
gcataaaatagcactatagagaaaaatggcatttacatctgagacacgatatcatatgagagtaaatcagaaaaatagcagcagctcgtcgtgaaaagaa |
20539517 |
T |
 |
| Q |
130 |
aagaaacaaatcctgccattcaattgtctgaaggt |
164 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
20539516 |
aagaaacaaatcctgccattcaatcgtctgaaggt |
20539482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 205 - 284
Target Start/End: Complemental strand, 20539441 - 20539361
Alignment:
| Q |
205 |
tctcaagatttttagtgagattgttgaaggattgtagtatgtatattttt-aaggaaatgttatctggtgtcctagaacat |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||| ||||||||||||| ||||||| |||| |||||||| ||||||| |
|
|
| T |
20539441 |
tctcaagatttttagtgagattgtttaaggagtgtattatgtatatttttaaaggaaaagttaattggtgtcccagaacat |
20539361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University