View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_120 (Length: 254)
Name: NF1358_high_120
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_120 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 39000323 - 39000550
Alignment:
| Q |
1 |
ctaatcgataaaagatatatacgagaaccaaattgaataacaaatgagaaattttgatgtatgtttttgtaattttcgtatatttatggactaaatgaca |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39000323 |
ctaatcgataaaagacatc--cgagaaccaaattgattaacaaatgagaaatttcaatgtatgtttttgtaattttcgtatattcatggactaaatgaca |
39000420 |
T |
|
| Q |
101 |
aggactcacaaaaattactatttacacttctttctttggtgt-----tttgctttgcttgataatgcagcttccgtatttagtgcataatttcctccact |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000421 |
agaactcacaaaaattactatttacacttctttctttcgtgttttgctttgctttgcttgataatgcagcttccgtatttagtgcataatttcctccact |
39000520 |
T |
|
| Q |
196 |
catagtattggtgttggaggacccacttgc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39000521 |
catagtattggtgttggaggacccacttgc |
39000550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University