View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_127 (Length: 239)
Name: NF1358_high_127
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_127 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 13624827 - 13625014
Alignment:
| Q |
1 |
tcagttaaactttaagaaccaaagtgattaatgtctcattgagaggtgcaattaaaggaggggattgcaaagagtaaataattaacttattgaaatgaca |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13624827 |
tcagttcaactttaagaaccaaattgattaatgtctcattgagaggtgcaattaaaggaggggattgcaaagagtaaataattaacttattgaaatgaca |
13624926 |
T |
|
| Q |
101 |
ccaacatgaacccattgaattaacttatcttagaactttttatagattaacttgaatatttactcctattaacttcctaggaggagtt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13624927 |
ccaacatgaacccattgaattaacttatctttgaactttttatagattaacttgaatatttactcctattaacttcctaggaggagtt |
13625014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University