View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_129 (Length: 233)
Name: NF1358_high_129
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_129 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 6516994 - 6517198
Alignment:
| Q |
1 |
atttggtatgattttgctacaaattatcactgcaaagcctccaatgggtttgtctcatttagttgaagaagctataaagaaaagaaacttcatgaacgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
6516994 |
atttggtatgattttgctacaaattatcactgcaaagcctccaatgggtttatctcatatagttgaagaagctataaaaaaaggaaacttcatgaacgtg |
6517093 |
T |
|
| Q |
101 |
cttgatccaaatgtaccaaattgtcctgttgaagaggctttggcatgtgctaagctggctttaaagtgtactgagtatagaaaacgtgatagacctgatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6517094 |
cttgatccaaatgtaccaaattgtcctgttgaagaggctttggcatgtgctaagctggctttaaagtgtattgagtatagaaaacgtgatagacctgatc |
6517193 |
T |
|
| Q |
201 |
ttgct |
205 |
Q |
| |
|
||||| |
|
|
| T |
6517194 |
ttgct |
6517198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University