View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_135 (Length: 213)
Name: NF1358_high_135
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_135 |
 |  |
|
| [»] scaffold0161 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 32457184 - 32457280
Alignment:
| Q |
1 |
gccggagtgttgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457184 |
gccggagtgttgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
32457280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 32463951 - 32463855
Alignment:
| Q |
1 |
gccggagtgttgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32463951 |
gccggagtgttgggggaaaggacggagacgacgtcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
32463855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 23375 - 23279
Alignment:
| Q |
1 |
gccggagtgttgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
97 |
Q |
| |
|
|||||||||||||| || |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
23375 |
gccggagtgttgggagagaggacggagacgacgtcgccttttacgatgccgagggaagaaagtgatgaagcaagttgaagacatcgtttatgggttt |
23279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University