View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_140 (Length: 203)
Name: NF1358_high_140
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_140 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 126
Target Start/End: Original strand, 2246538 - 2246661
Alignment:
| Q |
3 |
tttttaaatatctcttatgatatgtattttgaaagaaataaaatatgatctacttaaacattttttatccaggtttacttcactaaaactaatcctcgtt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2246538 |
tttttaaatatctcttatgatatgtattttgaaagaaataaaatatgatctacttaaacattttttaaccaggtttacttcactaaaactaatcctcgtt |
2246637 |
T |
 |
| Q |
103 |
gaccacctttagtataatctaccc |
126 |
Q |
| |
|
||||||||| ||||| || ||||| |
|
|
| T |
2246638 |
gaccaccttcagtatgatttaccc |
2246661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University