View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1358_high_144 (Length: 202)

Name: NF1358_high_144
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1358_high_144
NF1358_high_144
[»] chr4 (1 HSPs)
chr4 (35-100)||(2246460-2246525)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 35 - 100
Target Start/End: Complemental strand, 2246525 - 2246460
Alignment:
35 gtacaagctttttcatgtgtgtaacacttcatagtttctgatgcaggaagtaattttctcaatgtt 100  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||    
2246525 gtacaagctttttcatgtgtgtaacacttcatagttttttatgcaggaagtaattttctcaatgtt 2246460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University