View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_88 (Length: 323)
Name: NF1358_high_88
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_88 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 30 - 310
Target Start/End: Original strand, 32238352 - 32238639
Alignment:
| Q |
30 |
cttgtcaactgaactatgttcacgaggacgtaatataatgcttattatgcaacccatataannnnnnnn---accataaactagactatatcatataann |
126 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32238352 |
cttgttaactgaactatgttcacgaggacgtaatctaatgcttattatgcaacccatataatttttttttttaccataaactagactatatcatataatt |
32238451 |
T |
 |
| Q |
127 |
nnnnnnnnn----accataaactatactatatatatgcacataattgaaattttatttgataaaggatacaaagcaacccatgctaactctcaaaacacc |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32238452 |
tttttttttttttaccataaaccatactatatatatgcacataattgaaattttatttgataaaggatacaaagcaacccatgctaactctcaaaacacc |
32238551 |
T |
 |
| Q |
223 |
atgtgctcccaaacagtcttttccaactttgcatgctttaaaacctgtaattcaatatttgttagaatttgagacattgaaatgagaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32238552 |
atgtgctcccaaacagtcttttccaactttgcatgctttaaaacctgtaattcaatatttgttagaatttgagacattgaaatgagaa |
32238639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 188 - 271
Target Start/End: Complemental strand, 43666025 - 43665942
Alignment:
| Q |
188 |
gatacaaagcaacccatgctaactctcaaaacaccatgtgctcccaaacagtcttttccaactttgcatgctttaaaacctgta |
271 |
Q |
| |
|
|||||||||||||||| ||| || | ||||||||| | || |||||||||||||||||| | |||||| |||| || |||||| |
|
|
| T |
43666025 |
gatacaaagcaacccaagctcacacgcaaaacaccttcagcacccaaacagtcttttccaccattgcatccttttaatcctgta |
43665942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University