View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_high_99 (Length: 300)
Name: NF1358_high_99
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_high_99 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 71 - 300
Target Start/End: Original strand, 24879283 - 24879512
Alignment:
| Q |
71 |
gaaggcggtacgagtagtttaaatttgtctgaattagaacttggtttcaaagggtgtttgaatcttaatccagaacaattaccttccacaacagtaacaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24879283 |
gaaggcggtacgagtagtttaaatttgtctgaattagaacttggtttcaaagggtgtttgaatcttaatccagaacaattaccatccacaacagtaacaa |
24879382 |
T |
 |
| Q |
171 |
attttagtgagttcaattctatgcaaacccttcaaaaagatagaattgatcattgtagtaatattcatgatgatgctttgaatgtgaattttgagctacc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24879383 |
attttagtgagttcaattctatgcaaacccttcaaaaagatagaattgatcattgtagtaatattcatgatgatggtttgaatgtgaattttgagctacc |
24879482 |
T |
 |
| Q |
271 |
acctttaccaggtgaagaggattcaccatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24879483 |
acctttaccaggtgaagaggattcaccatc |
24879512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University