View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_105 (Length: 313)
Name: NF1358_low_105
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_105 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 33204438 - 33204622
Alignment:
| Q |
30 |
gtggagagaggcgttttacggcgccggaatgaggccggtgcagttgagtcagtttgcggattttcaagcggagtgtttgcttgcgaaggtgcaaatcaga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33204438 |
gtggagagaggcgttttacggcgccggaatgaggccggtgcagttgagtcagtttgcggattttcaagcggagtgtttgcttgcgaaggtacaaatcaga |
33204537 |
T |
|
| Q |
130 |
ggcttccacgtggcgaaacgacaagctgagttggtgcttttctggcatgagagggccatggttgccacgtcagcttggcggtgtt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33204538 |
ggcttccacgtggcgaaacgacaagctgagttggtgcttttctggcatgagagggccatggttgccacgtcagcttggcggtgtt |
33204622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 277 - 313
Target Start/End: Original strand, 33204685 - 33204721
Alignment:
| Q |
277 |
tcacattagcaagaatgtaaatttaatttaaatttaa |
313 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33204685 |
tcacattagcaagaatgtaattttaatttaactttaa |
33204721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 42 - 209
Target Start/End: Complemental strand, 7487949 - 7487782
Alignment:
| Q |
42 |
gttttacggcgccggaatgaggccggtgcagttgagtcagtttgcggattttcaagcggagtgtttgcttgcgaaggtgcaaatcagaggcttccacgtg |
141 |
Q |
| |
|
|||| |||| ||||| ||| |||||| |||||||| | ||||||||| ||||| |||||||||||| | || ||| ||| | || || ||||||||| |
|
|
| T |
7487949 |
gtttcacggtgccggtttgaagccggttcagttgagccggtttgcggaatttcatgcggagtgtttgttggctaagtcccaagttaggggattccacgtg |
7487850 |
T |
|
| Q |
142 |
gcgaaacgacaagctgagttggtgcttttctggcatgagagggccatggttgccacgtcagcttggcg |
209 |
Q |
| |
|
|| ||||| | ||||||||||| || | ||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
7487849 |
gcaaaacgcgaggctgagttggttctctgttggcatgagcgggccatggttgccacatcagcttggcg |
7487782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University