View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_109 (Length: 309)
Name: NF1358_low_109
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_109 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 179 - 281
Target Start/End: Original strand, 10981902 - 10982004
Alignment:
| Q |
179 |
tatattttgagatgaacataatataaatgggcatttaatgcagaatttgaattggccaacccttactccttgctattaatgggagaatgacagaacgagt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10981902 |
tatattttgagatgaacataatataaatgggcatttaatgcagaatttgaattggccaacccttactccttgctattaatgggagaatgacagaacgagt |
10982001 |
T |
 |
| Q |
279 |
aga |
281 |
Q |
| |
|
||| |
|
|
| T |
10982002 |
aga |
10982004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 10 - 81
Target Start/End: Original strand, 10981368 - 10981439
Alignment:
| Q |
10 |
attatacttacttcacaatcgaatttcatgttatcagtatctattttccctgaaaattgaaagattaacaac |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
10981368 |
attatacttacttcacaatcgaatttcatgttatcagtatctatttcccttgaaaattgaaagattaacaac |
10981439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University